Basic information   
Locus name AT2G47585
AliasmiR164A
OrganismArabidopsis thaliana
Taxonomic identifier[NCBI]
Function categoryTranscription regulation:MircoRNA
Effect for Senescencedelay
Gene DescriptionEncodes a microRNA that targets several genes containing NAC domains including NAC1 and ORE1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets CUC2 and modulates the extent of leaf margin serration. Also targets ORE1 to negatively regulate the timing of leaf senescence. Mature sequence: UGGAGAAGCAGGGCACGUGCA
EvidenceGenetic evidence:Transgene and mutant [Ref 1]
References
1: Kim JH, Woo HR, Kim J, Lim PO, Lee IC, Choi SH, Hwang D, Nam HG
Trifurcate feed-forward regulation of age-dependent cell death involving miR164 in Arabidopsis.
Science 2009 Feb 20;323(5917):1053-7

SequenceAT2G47585.1 | Genomic | mRNA
Mutant information   
Mutated 1
Mutant name mir164a-4
Mutant/Transgenic mutant
Ecotype Col-0
Mutagenesis type T-DNA insertion_knock out
Mutated 2
Mutant name miR164Aox
Mutant/Transgenic transgenic
Ecotype Ws
Mutagenesis type transgene
Mutated 3
Mutant name mir164abc
Mutant/Transgenic mutant
Ecotype Col-0
Mutagenesis type cross

© Center for Bioinformatics(CBI), Peking University